library construction Search Results


smarttm cdna library construction kit  (TaKaRa)
96
TaKaRa smarttm cdna library construction kit
Smarttm Cdna Library Construction Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/SMART+cDNA+Library+Construction+Kit/10__21475_slash_poj__16__09__03__p7816-135-20-25
Average 96 stars, based on 1 article reviews
smarttm cdna library construction kit - by Bioz Stars, 2026-11
96/100 stars
  Buy from Supplier
ctttcaggcacagtaagccagc 30 macrogen n a 1st pcr sctcr gd library generation reverse primers  (Macrogen)
86
Macrogen ctttcaggcacagtaagccagc 30 macrogen n a 1st pcr sctcr gd library generation reverse primers
Ctttcaggcacagtaagccagc 30 Macrogen N A 1st Pcr Sctcr Gd Library Generation Reverse Primers, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/construction+library/pmc10829794__mmc2-168-27-28
Average 86 stars, based on 1 article reviews
ctttcaggcacagtaagccagc 30 macrogen n a 1st pcr sctcr gd library generation reverse primers - by Bioz Stars, 2026-11
86/100 stars
  Buy from Supplier
fragments 10 kbp and a library was constructed using a ligation sequencing kit  (Oxford Nanopore)
97
Oxford Nanopore fragments 10 kbp and a library was constructed using a ligation sequencing kit
Fragments 10 Kbp And A Library Was Constructed Using A Ligation Sequencing Kit, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/Ligation+Sequencing+Kit/pmc11320934-39-18-31
Average 97 stars, based on 1 article reviews
fragments 10 kbp and a library was constructed using a ligation sequencing kit - by Bioz Stars, 2026-11
97/100 stars
  Buy from Supplier
fosmid library construction actinoplanes sp. se50/110  (IIT Biotech GmbH)
90
IIT Biotech GmbH fosmid library construction actinoplanes sp. se50/110
Scatter plot of 600 Actinoplanes sp. <t>SE50/110</t> contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.
Fosmid Library Construction Actinoplanes Sp. Se50/110, supplied by IIT Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/fosmid+library+construction+actinoplanes+sp++se50+110/pmc03364876-230-7-25
Average 90 stars, based on 1 article reviews
fosmid library construction actinoplanes sp. se50/110 - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
customized dna library construction  (Medigenomix GmbH)
90
Medigenomix GmbH customized dna library construction
Scatter plot of 600 Actinoplanes sp. <t>SE50/110</t> contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.
Customized Dna Library Construction, supplied by Medigenomix GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/customized+dna+library+construction/pmc02916918-119-0-7
Average 90 stars, based on 1 article reviews
customized dna library construction - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
hts cdna library construction  (Almaz Optics Inc)
90
Almaz Optics Inc hts cdna library construction
Scatter plot of 600 Actinoplanes sp. <t>SE50/110</t> contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.
Hts Cdna Library Construction, supplied by Almaz Optics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/hts+cdna+library+construction/pmc11512384-72-20-16
Average 90 stars, based on 1 article reviews
hts cdna library construction - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
metavenom library design and construction  (Johns Hopkins HealthCare)
90
Johns Hopkins HealthCare metavenom library design and construction
Scatter plot of 600 Actinoplanes sp. <t>SE50/110</t> contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.
Metavenom Library Design And Construction, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/metavenom+library+design+and+construction/pmc11833617-380-26-20
Average 90 stars, based on 1 article reviews
metavenom library design and construction - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
smart cdna library construction kit  (Becton Dickinson)
90
Becton Dickinson smart cdna library construction kit
Scatter plot of 600 Actinoplanes sp. <t>SE50/110</t> contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.
Smart Cdna Library Construction Kit, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/smart+cdna+library+construction+kit/pmc00166519-408-24-29
Average 90 stars, based on 1 article reviews
smart cdna library construction kit - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
cdna library construction  (Biomarker Technologies Co)
90
Biomarker Technologies Co cdna library construction
Scatter plot of 600 Actinoplanes sp. <t>SE50/110</t> contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.
Cdna Library Construction, supplied by Biomarker Technologies Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/cdna+library+construction/pmc11748453-66-1-7
Average 90 stars, based on 1 article reviews
cdna library construction - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
cdna library construction  (LC Bio Co Ltd)
90
LC Bio Co Ltd cdna library construction
Scatter plot of 600 Actinoplanes sp. <t>SE50/110</t> contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.
Cdna Library Construction, supplied by LC Bio Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/cdna+library+construction/pm26801211-338-21-15
Average 90 stars, based on 1 article reviews
cdna library construction - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
cdna library construction and rna sequencing  (Sinotech Engineering Consultants)
90
Sinotech Engineering Consultants cdna library construction and rna sequencing
Scatter plot of 600 Actinoplanes sp. <t>SE50/110</t> contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.
Cdna Library Construction And Rna Sequencing, supplied by Sinotech Engineering Consultants, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/cdna+library+construction/pm37786776-83-20-9
Average 90 stars, based on 1 article reviews
cdna library construction and rna sequencing - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
cdna library construction  (Welgene inc)
90
Welgene inc cdna library construction
Scatter plot of 600 Actinoplanes sp. <t>SE50/110</t> contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.
Cdna Library Construction, supplied by Welgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/library+construction/cdna+library+construction/pmc06934447-161-1-12
Average 90 stars, based on 1 article reviews
cdna library construction - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier

Image Search Results


Scatter plot of 600 Actinoplanes sp. SE50/110 contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.

Journal: BMC Genomics

Article Title: The complete genome sequence of the acarbose producer Actinoplanes sp. SE50/110

doi: 10.1186/1471-2164-13-112

Figure Lengend Snippet: Scatter plot of 600 Actinoplanes sp. SE50/110 contigs resulting from automatic combined assembly of the paired end and whole genome shotgun pyrosequencing runs . The average number of reads per base is 43.88 and is depicted in the plot by the central diagonal line marked with 'average'. Additional lines indicate the factor of over- and underrepresentation of reads per base up to a factor of 10 and 1/10 fold, respectively. The axes represent logarithmic scales.

Article Snippet: The fosmid library construction for Actinoplanes sp. SE50/110 with an average inset size of 40 kb has been carried out on isolated genomic DNA by IIT Biotech GmbH (Universitätsstrasse 25, 33615 Bielefeld, Germany).

Techniques:

Scaffolds of the Actinoplanes sp. SE50/110 genome . (A) The eight paired end (PE) scaffolds resulting from Newbler assembly of all paired end and whole genome shotgun reads are shown. Every second contig is visualized in a slightly displaced manner to show contig boundaries. (B) The three scaffolds resulting from terminal insert sequencing of fosmid (FO) clones and subsequent mapping on the PE scaffolds are presented. All overlapping sequences of the 609 mapped fosmid clones are shown on top of the PE/FO scaffolds.

Journal: BMC Genomics

Article Title: The complete genome sequence of the acarbose producer Actinoplanes sp. SE50/110

doi: 10.1186/1471-2164-13-112

Figure Lengend Snippet: Scaffolds of the Actinoplanes sp. SE50/110 genome . (A) The eight paired end (PE) scaffolds resulting from Newbler assembly of all paired end and whole genome shotgun reads are shown. Every second contig is visualized in a slightly displaced manner to show contig boundaries. (B) The three scaffolds resulting from terminal insert sequencing of fosmid (FO) clones and subsequent mapping on the PE scaffolds are presented. All overlapping sequences of the 609 mapped fosmid clones are shown on top of the PE/FO scaffolds.

Article Snippet: The fosmid library construction for Actinoplanes sp. SE50/110 with an average inset size of 40 kb has been carried out on isolated genomic DNA by IIT Biotech GmbH (Universitätsstrasse 25, 33615 Bielefeld, Germany).

Techniques: Sequencing, Clone Assay

Plot of the complete Actinoplanes sp. SE50/110 genome . The genome consists of 9,239,851 base pairs and 8,270 predicted coding sequences. The circles represent from the inside: 1, scale in million base pairs; 2, GC skew; 3, G + C content (blue above- and black below genome average); 4, genes in backward direction; 5, genes in forward direction; 6, gene clusters and other sites of special interest. Abbrevations were used as follows: oriC , origin of replication; dif , chromosomal terminus region; rrn , ribosomal operon; NRPS, non-ribosomal peptide synthetase; PKS, polyketide synthase; AICE, actinomycete integrative and conjugative element.

Journal: BMC Genomics

Article Title: The complete genome sequence of the acarbose producer Actinoplanes sp. SE50/110

doi: 10.1186/1471-2164-13-112

Figure Lengend Snippet: Plot of the complete Actinoplanes sp. SE50/110 genome . The genome consists of 9,239,851 base pairs and 8,270 predicted coding sequences. The circles represent from the inside: 1, scale in million base pairs; 2, GC skew; 3, G + C content (blue above- and black below genome average); 4, genes in backward direction; 5, genes in forward direction; 6, gene clusters and other sites of special interest. Abbrevations were used as follows: oriC , origin of replication; dif , chromosomal terminus region; rrn , ribosomal operon; NRPS, non-ribosomal peptide synthetase; PKS, polyketide synthase; AICE, actinomycete integrative and conjugative element.

Article Snippet: The fosmid library construction for Actinoplanes sp. SE50/110 with an average inset size of 40 kb has been carried out on isolated genomic DNA by IIT Biotech GmbH (Universitätsstrasse 25, 33615 Bielefeld, Germany).

Techniques:

Features of the Actinoplanes sp. SE50/110 genome

Journal: BMC Genomics

Article Title: The complete genome sequence of the acarbose producer Actinoplanes sp. SE50/110

doi: 10.1186/1471-2164-13-112

Figure Lengend Snippet: Features of the Actinoplanes sp. SE50/110 genome

Article Snippet: The fosmid library construction for Actinoplanes sp. SE50/110 with an average inset size of 40 kb has been carried out on isolated genomic DNA by IIT Biotech GmbH (Universitätsstrasse 25, 33615 Bielefeld, Germany).

Techniques:

Functional classifications of the Actinoplanes sp. SE50/110 protein coding sequences (CDS) . The diagram represents the CDS that were categorized according their cluster of orthologous groups of proteins (COG) number [ , ]. All depicted percentages refer to the distribution of 4999 annotated CDS (100%) across all COG categories to which at least 10 CDS were found. Sequences with an unknown or poorly characterized function were excluded from the analysis. These excluded CDS were found to be rather randomly distributed across the genome. The outer ring contains specialized subclasses of the three main functional categories

Journal: BMC Genomics

Article Title: The complete genome sequence of the acarbose producer Actinoplanes sp. SE50/110

doi: 10.1186/1471-2164-13-112

Figure Lengend Snippet: Functional classifications of the Actinoplanes sp. SE50/110 protein coding sequences (CDS) . The diagram represents the CDS that were categorized according their cluster of orthologous groups of proteins (COG) number [ , ]. All depicted percentages refer to the distribution of 4999 annotated CDS (100%) across all COG categories to which at least 10 CDS were found. Sequences with an unknown or poorly characterized function were excluded from the analysis. These excluded CDS were found to be rather randomly distributed across the genome. The outer ring contains specialized subclasses of the three main functional categories "Cellular Processes and Signaling", "Metabolism", and "Information Storage and Processing", located at the center.

Article Snippet: The fosmid library construction for Actinoplanes sp. SE50/110 with an average inset size of 40 kb has been carried out on isolated genomic DNA by IIT Biotech GmbH (Universitätsstrasse 25, 33615 Bielefeld, Germany).

Techniques: Functional Assay

Phylogenetic tree based on 16S rDNA from Actinoplanes sp. SE50/110 and the 34 most closely related species . Shown is an excerpt of a phylogenetic tree build from the 100 best nucleotide BLAST hits for the Actinoplanes sp. SE50/110 16S rDNA. The shown subtree contains the 34 hits most closely related to Actinoplanes sp. SE50/110 (black arrow) with their evolutionary distances. The numbers on the branches represent confidence values in percent from a phylogenetic bootstrap test (1000 replications). The evolutionary history was inferred using the Neighbor-Joining method . The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed . The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Jukes-Cantor method and are in the units of the number of base substitutions per site. The analysis involved 100 nucleotide sequences of which 35 are shown. Codon positions included were 1st + 2nd + 3 rd + Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 1396 positions in the final dataset. Evolutionary analyses were conducted in MEGA5 . Bar, 0.002 nucleotide substitutions per nucleotide position.

Journal: BMC Genomics

Article Title: The complete genome sequence of the acarbose producer Actinoplanes sp. SE50/110

doi: 10.1186/1471-2164-13-112

Figure Lengend Snippet: Phylogenetic tree based on 16S rDNA from Actinoplanes sp. SE50/110 and the 34 most closely related species . Shown is an excerpt of a phylogenetic tree build from the 100 best nucleotide BLAST hits for the Actinoplanes sp. SE50/110 16S rDNA. The shown subtree contains the 34 hits most closely related to Actinoplanes sp. SE50/110 (black arrow) with their evolutionary distances. The numbers on the branches represent confidence values in percent from a phylogenetic bootstrap test (1000 replications). The evolutionary history was inferred using the Neighbor-Joining method . The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed . The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Jukes-Cantor method and are in the units of the number of base substitutions per site. The analysis involved 100 nucleotide sequences of which 35 are shown. Codon positions included were 1st + 2nd + 3 rd + Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 1396 positions in the final dataset. Evolutionary analyses were conducted in MEGA5 . Bar, 0.002 nucleotide substitutions per nucleotide position.

Article Snippet: The fosmid library construction for Actinoplanes sp. SE50/110 with an average inset size of 40 kb has been carried out on isolated genomic DNA by IIT Biotech GmbH (Universitätsstrasse 25, 33615 Bielefeld, Germany).

Techniques:

Phylogenetic tree based on coding sequences (CDS) from Actinoplanes sp. SE50/110 and six species of the family Micromonosporaceae as well as Streptomyces and Frankia strains . The tree was constructed using the software tool EDGAR based on 605 core genome CDS from the species occurring in the analysis. The comparision shows all seven strains of the taxonomic family Micromonosporaceae sequenced and publicly available to date in relation to other well studied bacteria.

Journal: BMC Genomics

Article Title: The complete genome sequence of the acarbose producer Actinoplanes sp. SE50/110

doi: 10.1186/1471-2164-13-112

Figure Lengend Snippet: Phylogenetic tree based on coding sequences (CDS) from Actinoplanes sp. SE50/110 and six species of the family Micromonosporaceae as well as Streptomyces and Frankia strains . The tree was constructed using the software tool EDGAR based on 605 core genome CDS from the species occurring in the analysis. The comparision shows all seven strains of the taxonomic family Micromonosporaceae sequenced and publicly available to date in relation to other well studied bacteria.

Article Snippet: The fosmid library construction for Actinoplanes sp. SE50/110 with an average inset size of 40 kb has been carried out on isolated genomic DNA by IIT Biotech GmbH (Universitätsstrasse 25, 33615 Bielefeld, Germany).

Techniques: Construct, Software

The structure of the acarbose biosynthetic gene cluster from Actinoplanes sp. SE50/110 . Based on the whole genome sequence, several nucleotide corrections were found with respect to the previously sequenced reference sequence of the acarbose gene cluster [GenBank: Y18523.4 ]. The corrected sites in acbC and acbE are marked by arrows and red dashes.

Journal: BMC Genomics

Article Title: The complete genome sequence of the acarbose producer Actinoplanes sp. SE50/110

doi: 10.1186/1471-2164-13-112

Figure Lengend Snippet: The structure of the acarbose biosynthetic gene cluster from Actinoplanes sp. SE50/110 . Based on the whole genome sequence, several nucleotide corrections were found with respect to the previously sequenced reference sequence of the acarbose gene cluster [GenBank: Y18523.4 ]. The corrected sites in acbC and acbE are marked by arrows and red dashes.

Article Snippet: The fosmid library construction for Actinoplanes sp. SE50/110 with an average inset size of 40 kb has been carried out on isolated genomic DNA by IIT Biotech GmbH (Universitätsstrasse 25, 33615 Bielefeld, Germany).

Techniques: Sequencing

Structural organization of the newly identified actinomycete integrative and conjugative element (AICE) pACPL from Actinoplanes sp. SE50/110 in comparison with other AICEs from closely related species . ( A ) pACPL (13.6 kb), the first AICE found in the Actinoplanes genus from Actinoplanes sp. SE50/110; ( B ) pSAM2 (10.9 kb) from Streptomyces ambofaciens ; ( C ) pMR2 (11.2 kb) from Micromonospora rosaria SCC2095; ( D ) SLP1 (17.3 kb) from Streptomyces coelicolor A3(2); ( E, F ) AICE Sare 1562 (13.3 kb) and AICE Sare 1922 (14.4 kb) from Salinispora arenicola CNS-205; ( G ) AICE Strop 0058 (14.9 kb) from Salinispora tropica CNB-440. B-G adapted from .

Journal: BMC Genomics

Article Title: The complete genome sequence of the acarbose producer Actinoplanes sp. SE50/110

doi: 10.1186/1471-2164-13-112

Figure Lengend Snippet: Structural organization of the newly identified actinomycete integrative and conjugative element (AICE) pACPL from Actinoplanes sp. SE50/110 in comparison with other AICEs from closely related species . ( A ) pACPL (13.6 kb), the first AICE found in the Actinoplanes genus from Actinoplanes sp. SE50/110; ( B ) pSAM2 (10.9 kb) from Streptomyces ambofaciens ; ( C ) pMR2 (11.2 kb) from Micromonospora rosaria SCC2095; ( D ) SLP1 (17.3 kb) from Streptomyces coelicolor A3(2); ( E, F ) AICE Sare 1562 (13.3 kb) and AICE Sare 1922 (14.4 kb) from Salinispora arenicola CNS-205; ( G ) AICE Strop 0058 (14.9 kb) from Salinispora tropica CNB-440. B-G adapted from .

Article Snippet: The fosmid library construction for Actinoplanes sp. SE50/110 with an average inset size of 40 kb has been carried out on isolated genomic DNA by IIT Biotech GmbH (Universitätsstrasse 25, 33615 Bielefeld, Germany).

Techniques:

The gene organization of the four putative secondary metabolite gene clusters found in the Actinoplanes sp. SE50/110 genome . ( A ) Non-ribosomal peptide synthetase (NRPS) cluster showing high structural and sequential similarity to the SMC14 gene cluster identified on the pSCL4 megaplasmid from Streptomyces clavuligerus ATCC 27064. ( B ) Large polyketide synthase (PKS) gene cluster exhibiting 62-66% similarity to PKSs from various Streptomyces strains. ( C ) A single PKS gene with various accessory genes showing some structural similarity to a yet uncharacterized PKS gene cluster of Salinispora tropica CNB-440. ( D ) Putative hybrid NRPS/PKS gene cluster with NRPS genes showing high similarity (63-76%) to genes from an uncharacterized cluster of Streptomyces venezuelae ATCC 10712 whereas the PKS genes exhibit highest similarity (63-66%) to genes scattered in the Methylosinus trichosporium OB3b genome.

Journal: BMC Genomics

Article Title: The complete genome sequence of the acarbose producer Actinoplanes sp. SE50/110

doi: 10.1186/1471-2164-13-112

Figure Lengend Snippet: The gene organization of the four putative secondary metabolite gene clusters found in the Actinoplanes sp. SE50/110 genome . ( A ) Non-ribosomal peptide synthetase (NRPS) cluster showing high structural and sequential similarity to the SMC14 gene cluster identified on the pSCL4 megaplasmid from Streptomyces clavuligerus ATCC 27064. ( B ) Large polyketide synthase (PKS) gene cluster exhibiting 62-66% similarity to PKSs from various Streptomyces strains. ( C ) A single PKS gene with various accessory genes showing some structural similarity to a yet uncharacterized PKS gene cluster of Salinispora tropica CNB-440. ( D ) Putative hybrid NRPS/PKS gene cluster with NRPS genes showing high similarity (63-76%) to genes from an uncharacterized cluster of Streptomyces venezuelae ATCC 10712 whereas the PKS genes exhibit highest similarity (63-66%) to genes scattered in the Methylosinus trichosporium OB3b genome.

Article Snippet: The fosmid library construction for Actinoplanes sp. SE50/110 with an average inset size of 40 kb has been carried out on isolated genomic DNA by IIT Biotech GmbH (Universitätsstrasse 25, 33615 Bielefeld, Germany).

Techniques: